Coding
Part:BBa_K4769218:Design
Designed by: Kieran Abbott Group: iGEM23_Cambridge (2023-10-10)
Porphyran utilisation locus fragment 1
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 1097
Illegal XbaI site found at 3641
Illegal XbaI site found at 4611
Illegal SpeI site found at 1716
Illegal PstI site found at 5057 - 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1097
Illegal SpeI site found at 1716
Illegal PstI site found at 5057 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1097
Illegal BamHI site found at 6600 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 1097
Illegal XbaI site found at 3641
Illegal XbaI site found at 4611
Illegal SpeI site found at 1716
Illegal PstI site found at 5057 - 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 1097
Illegal XbaI site found at 3641
Illegal XbaI site found at 4611
Illegal SpeI site found at 1716
Illegal PstI site found at 5057
Illegal NgoMIV site found at 1974
Illegal AgeI site found at 977
Illegal AgeI site found at 4756 - 1000INCOMPATIBLE WITH RFC[1000]Illegal SapI.rc site found at 6070
Design Notes
N/A
Source
P. plebeius genome
Primers for cloning: FW: gctcatatttaaaaataccactctatatagatagaaatacc (+ desired overhangs) RV: ttagaaattaagacttaaaccaaatctgaatgtac (+ desired overhangs)